Change in the way equals() is evaluated for Results, Hits, Hsps.Modif…

…ied tests accordingly.
josemduarte · Nov 12, 2015 · Sep 9, 2015 · Sep 15, 2015 · Sep 17, 2015 · Sep 18, 2015
commit 26eaebf2cd88d069855645431124771de5348312
diff --git a/biojava-core/src/main/java/org/biojava/nbio/core/search/io/Hit.java b/biojava-core/src/main/java/org/biojava/nbio/core/search/io/Hit.java
@@ -20,6 +20,9 @@ public abstract class Hit implements Iterable<Hsp>{
     private final String hitId;
     private final String hitDef;
     private final String hitAccession;
+    /**
+     * the length of the hit sequence
+     */
     private final int hitLen;
     private final List<Hsp> hsps;
     private Sequence hitSequence;
@@ -35,44 +38,37 @@ public Hit(int hitNum, String hitId, String hitDef, String hitAccession, int hit
         this.hsps = hsps;
         this.hitSequence = hitSequence;
     }
-
-    /**
-     * Experimental.
-     * Wants to return an hashcode designed to allow conceptual comparisons of search results.
+
+    @Override
+    public int hashCode() {
+        int hash = 3;
+        hash = 89 * hash + this.hitLen;
+        hash = 89 * hash + (this.hsps != null ? this.hsps.hashCode() : 0);
+        return hash;
+    }
+     /**
+     * Implements conceptual comparisons of search results.
      * Fields unrelated to search are deliberately not considered.
-     * 
-     * This latter wants to be a way to compare two hits such that 
-     * if two different queries hit for example chromososome 1, 
-     * with of course different alignments, they will remain still equals to comparison.
      * @return 
      */
-    public int hashCode(){
-        String allInOne = hitId+hitLen;
-        return allInOne.hashCode();
-    }
-    /**
-     * gets a String to be hashcoded representing contained hsp.
-     * @return null if hsp does not contain alignment information.
-     * @return an hashcode representing all hsp
-     */
-    String getHspsHashString(){
-        String cat = ""+hashCode();
-        if (hsps != null){
-            for (Hsp h: hsps){
-                //  hsp hashcode cannot be calculated
-                if (h.getHspQseq() == null && h.getHspIdentityString() == null && h.getHspHseq()==null) return null;
-                cat += h.getHspQseq()+"\n"+h.getHspIdentityString()+"\n"+h.getHspHseq()+"\n";
-            }
+    @Override
+    public boolean equals(Object obj) {
+        if (obj == null) {
+            return false;
+        }
+        if (getClass() != obj.getClass()) {
+            return false;
         }
-        return cat;
+        final Hit other = (Hit) obj;
+        if (this.hitLen != other.hitLen) {
+            return false;
+        }
+        if (this.hsps != other.hsps && (this.hsps == null || !this.hsps.equals(other.hsps))) {
+            return false;
+        }
+        return true;
     }
 
-    @Override
-    public boolean equals(Object o){
-        if (!(o instanceof Hit)) return false;
-
-        return o.hashCode() == this.hashCode();
-    }
     public int getHitNum() {
         return hitNum;
     }

diff --git a/biojava-core/src/main/java/org/biojava/nbio/core/search/io/Hsp.java b/biojava-core/src/main/java/org/biojava/nbio/core/search/io/Hsp.java
@@ -50,26 +50,43 @@ public abstract class Hsp <S extends Sequence<C>, C extends Compound> {
     private Double percentageIdentity = null;
     private Integer mismatchCount = null;
     private SimpleSequencePair<S, C> returnAln;
-
+
+    @Override
+    public int hashCode() {
+        int hash = 5;
+        hash = 67 * hash + (this.hspQseq != null ? this.hspQseq.hashCode() : 0);
+        hash = 67 * hash + (this.hspHseq != null ? this.hspHseq.hashCode() : 0);
+        hash = 67 * hash + (this.hspIdentityString != null ? this.hspIdentityString.hashCode() : 0);
+        return hash;
+    }
     /**
      * Experimental.
-     * Wants to return an hashcode designed to allow conceptual comparisons of search results.
      * Wants to implement conceptual comparisons of search results.
      * Fields unrelated to search are deliberately not considered.
-     * @return 
+     * 
+     * In HSP case, alignment representation strings are considered.
+     * @return true if HSP alignments are the same, 
+     * false otherwise or if alignment strings are undetermined
      */
-    public int hashCode(){
-        String allInOne = hspQseq+"\n"+hspIdentityString+"\n"+hspHseq;
-        return allInOne.hashCode();
-    }
-
     @Override
-    public boolean equals(Object o){
-        if (!(o instanceof Hsp)) return false;
-        Hsp other = (Hsp)o;
-        //if (this.getRepresentationString()==null || other.getRepresentationString()==null) return false;
-
-        return o.hashCode() == this.hashCode();
+    public boolean equals(Object obj) {
+        if (obj == null) {
+            return false;
+        }
+        if (getClass() != obj.getClass()) {
+            return false;
+        }
+        final Hsp<?, ?> other = (Hsp<?, ?>) obj;
+        if ((this.hspQseq == null) ? (other.hspQseq != null) : !this.hspQseq.equals(other.hspQseq)) {
+            return false;
+        }
+        if ((this.hspHseq == null) ? (other.hspHseq != null) : !this.hspHseq.equals(other.hspHseq)) {
+            return false;
+        }
+        if ((this.hspIdentityString == null) ? (other.hspIdentityString != null) : !this.hspIdentityString.equals(other.hspIdentityString)) {
+            return false;
+        }
+        return true;
     }
 
     public SequencePair<S,C> getAlignment(){

diff --git a/biojava-core/src/main/java/org/biojava/nbio/core/search/io/Result.java b/biojava-core/src/main/java/org/biojava/nbio/core/search/io/Result.java
@@ -47,31 +47,41 @@ public Result(String program, String version, String reference, String dbFile, H
         this.hits = hits;
         this.querySequence = querySequence;
     }
+
+    @Override
+    public int hashCode() {
+        int hash = 7;
+        hash = 29 * hash + (this.queryID != null ? this.queryID.hashCode() : 0);
+        hash = 29 * hash + (this.queryDef != null ? this.queryDef.hashCode() : 0);
+        hash = 29 * hash + (this.hits != null ? this.hits.hashCode() : 0);
+        return hash;
+    }
     /**
      * Experimental.
      * Wants to return an hashcode designed to allow conceptual comparisons of search results.
      * Wants to implement conceptual comparisons of search results.
      * Fields unrelated to search are deliberately not considered.
      * @return 
      */
-    public int hashCode(){
-        String prefix = queryID+queryDef;
-        String suffix="";
-        if (hits != null){
-            for (Hit h: hits) {
-                String hashString = h.getHspsHashString();
-                if (hashString== null) return prefix.hashCode();
-                suffix += hashString;
-            }
-        }
-        return (prefix+suffix).hashCode();
-    }
-
     @Override
-    public boolean equals(Object o){
-        if (!(o instanceof Result)) return false;
-
-        return o.hashCode() == this.hashCode();
+    public boolean equals(Object obj) {
+        if (obj == null) {
+            return false;
+        }
+        if (getClass() != obj.getClass()) {
+            return false;
+        }
+        final Result other = (Result) obj;
+        if ((this.queryID == null) ? (other.queryID != null) : !this.queryID.equals(other.queryID)) {
+            return false;
+        }
+        if ((this.queryDef == null) ? (other.queryDef != null) : !this.queryDef.equals(other.queryDef)) {
+            return false;
+        }
+        if (this.hits != other.hits && (this.hits == null || !this.hits.equals(other.hits))) {
+            return false;
+        }
+        return true;
     }
 
     public int getIterationNumber() {

diff --git a/biojava-core/src/test/java/org/biojava/nbio/core/search/io/HspTest.java b/biojava-core/src/test/java/org/biojava/nbio/core/search/io/HspTest.java
@@ -13,11 +13,6 @@
 import org.junit.Ignore;
 
 /**
- * Designed by Paolo Pavan.
- * You may want to find my contacts on Github and LinkedIn for code info 
- * or discuss major changes.
- * https://github.com/paolopavan
- * 
  * @author Paolo Pavan
  */
 
@@ -83,13 +78,42 @@ public void testHashCode() {
         int expResult;
         int result;
 
-        instance = hspImpl;
-        expResult = 71782805;
+        instance = new BlastHspBuilder()
+                .setHspNum(1)
+                .setHspBitScore(377.211)
+                .setHspEvalue(8.04143e-093)
+                .setHspQueryFrom(1)
+                .setHspQueryTo(224)
+                .setHspHitFrom(1035)
+                .setHspHitTo(811)
+                .setHspQueryFrame(-1)
+                .setHspIdentity(213)
+                .setHspPositive(213)
+                .setHspGaps(5)
+                .setHspAlignLen(227)
+                .setHspQseq("CTGACGACAGCCATGCACCACCTGTCTCGACTTTCCCCCGAAGGGCACCTAATGTATCTCTACCTCGTTAGTCGGATGTCAAGACCTGGTAAGGTTTTTTCGCGTATCTTCGAATTAAACCACATACTCCACTGCTTGTGCGG-CCCCCGTCAATTCCTTTGAGTTTCAACCTTGCGGCCGTACTCCC-AGGTGGA-TACTTATTGTGTTAACTCCGGCACGGAAGG")
+                .setHspHseq("CTGACGACAACCATGCACCACCTGTCTCAACTTTCCCC-GAAGGGCACCTAATGTATCTCTACTTCGTTAGTTGGATGTCAAGACCTGGTAAGGTT-CTTCGCGTTGCTTCGAATTAAACCACATACTCCACTGCTTGTGCGGGCCCCCGTCAATTCCTTTGAGTTTCAACCTTGCGGTCGTACTCCCCAGGTGGATTACTTATTGTGTTAACTCCGGCACAGAAGG")
+                .setHspIdentityString("||||||||| |||||||||||||||||| ||||||||| |||||||||||||||||||||||| |||||||| |||||||||||||||||||||||  |||||||  |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||| ||||||| |||||||||||||||||||||||| |||||")
+                .createBlastHsp();
+
+        expResult = hspImpl.hashCode();
         result = instance.hashCode();
         assertEquals(expResult, result);
 
-        instance = uncompleteHsp;
-        expResult = 679;
+        instance = new BlastHspBuilder()
+                .setPercentageIdentity(100.00/100)
+                .setHspAlignLen(48)
+                .setMismatchCount(0)
+                .setHspGaps(0)
+                .setHspQueryFrom(1)
+                .setHspQueryTo(48)
+                .setHspHitFrom(344)
+                .setHspHitTo(391)
+                .setHspEvalue(4e-19)
+                .setHspBitScore(95.6)
+                .createBlastHsp();
+
+        expResult = uncompleteHsp.hashCode();
         result = instance.hashCode();
         assertEquals(expResult, result);
 
@@ -106,7 +130,7 @@ public void testHashCode() {
                 .setHspBitScore(95.6)
                 .createBlastHsp();
 
-        assertFalse(uncompleteHsp.hashCode() == uncompleteHsp2.hashCode());
+        assertEquals(uncompleteHsp.hashCode(), uncompleteHsp2.hashCode());
     }
 
     /**
@@ -137,7 +161,7 @@ public void testEquals() {
 
         assertEquals(o, instance);
 
-        // example of Hsp retrieved from uncomplete report. The result is null, hance false
+        // example of Hsp retrieved from uncomplete report.
         // (Those HSP may come from a tabular format, for example)
         o = new BlastHspBuilder()
                 .setPercentageIdentity(100.00/100)
@@ -152,8 +176,7 @@ public void testEquals() {
                 .setHspBitScore(95.6)
                 .createBlastHsp();
 
-        // At now, check will return false as it could be not determined
-        assertFalse(uncompleteHsp.equals(o));
+        assertEquals(uncompleteHsp, o);
     }
 
     /**

diff --git a/biojava-core/src/test/java/org/biojava/nbio/core/search/io/blast/BlastTabularParserTest.java b/biojava-core/src/test/java/org/biojava/nbio/core/search/io/blast/BlastTabularParserTest.java
@@ -76,7 +76,7 @@ public void testCreateObjects() throws Exception {
         Hit expHit1res1;
         Hsp expHsp1hit1res1;
 
-        String resource = "/org/biojava/nbio/core/search/io/blast/test.two-query.blasttxt";
+        String resource = "/org/biojava/nbio/core/search/io/blast/small-blastreport.blasttxt";
         URL resourceURL = getClass().getResource(resource);
         File file = new File(resourceURL.getFile());
 
@@ -87,25 +87,47 @@ public void testCreateObjects() throws Exception {
 
         BlastHsp hsp1Hit1Res1 = new BlastHspBuilder()
                 .setHspNum(1)
-                .setPercentageIdentity(97.40/100)
-                .setHspAlignLen(77)
-                .setMismatchCount(2)
+                .setPercentageIdentity(100.0/100)
+                .setHspAlignLen(1567)
+                .setMismatchCount(0)
                 .setHspGaps(0)
-                .setHspQueryFrom(774)
-                .setHspQueryTo(850)
-                .setHspHitFrom(45396566)
-                .setHspQueryTo(45396336)
-                .setHspEvalue(1e-46)
-                .setHspBitScore(157)
+                .setHspQueryFrom(1)
+                .setHspQueryTo(1567)
+                .setHspHitFrom(616309)
+                .setHspQueryTo(617875)
+                .setHspEvalue(0)
+                .setHspBitScore(2894)
                 .createBlastHsp();
 
+        BlastHsp hsp1Hit1Res2 = new BlastHspBuilder()
+                .setHspNum(1)
+                .setPercentageIdentity(100.0/100)
+                .setHspAlignLen(1567)
+                .setMismatchCount(0)
+                .setHspGaps(0)
+                .setHspQueryFrom(1)
+                .setHspQueryTo(1567)
+                .setHspHitFrom(1278699)
+                .setHspQueryTo(1277133)
+                .setHspEvalue(0)
+                .setHspBitScore(2894)
+                .createBlastHsp();
+
+        List<Hsp> hsplist = new ArrayList();
+        hsplist.add(hsp1Hit1Res1);
+        hsplist.add(hsp1Hit1Res2);
+
         BlastHit hit1Res1 = new BlastHitBuilder()
-                .setHitDef("chr15")
+                .setHitDef("CP000411")
+                .setHsps(hsplist)
                 .createBlastHit();
+        List<Hit> hitlist = new ArrayList();
+        hitlist.add(hit1Res1);
 
         BlastResult res1 = new BlastResultBuilder()
-                .setQueryID("Query_1")
-                .setQueryDef("Dual oxidase (DUOX1_RAT)")
+                .setQueryID("CP000411_-_16S_rRNA")
+                .setQueryDef("CP000411_-_16S_rRNA")
+                .setHits(hitlist)
                 .createBlastResult();
 
         expRes1 = results.get(0);
@@ -145,20 +167,10 @@ public void testCreateObjects() throws Exception {
                 .setHspBitScore(95.6)
                 .createBlastHsp();
 
-        hit1Res1 = new BlastHitBuilder()
-                .setHitDef("KF031625.1.1775")
-                .createBlastHit();
-
-        res1 = new BlastResultBuilder()
-                .setQueryID("1_759_906_F3")
-                .setQueryDef("1_759_906_F3")
-                .createBlastResult();
-
         // results test
-        assertEquals(expRes1, res1);
-        // hit test
-        assertEquals(expHit1res1, hit1Res1);
-        // hsp test
+        assertEquals(expRes1.getQueryID(), "1_759_906_F3");
+        assertEquals(results2.size(), 298);
+        // only one hsp test
         assertEquals(expHsp1hit1res1, hsp1Hit1Res1);
     }